For ITS2 amplification, PCR amplifications were performed as described previously using the following: primers 5.8S ATCACTCGGCTCGTGGATCG and 28S ATGCTTAAATTTAGGGGGTAGTC for ITS2. Species identification was completed using amplification of two genes: ITS2 and COI. Molecular analysis was performed on collected Anopheles mosquitoes to determine species and characterize the genetic variation within species. In this study, the ITS2 and the COI loci were sequenced and analysed for species identification in Anopheles specimens collected in two sites in east Ethiopia to evaluate the potential of these loci for identification of east Ethiopian Anopheles. Previous studies have highlighted how the analysis of the COI gene poses challenges for discriminating between closely related species such as those which belong to a species complex (for review see Beebe et al. Identifying the correct locus or loci for the basis of species or population-level analysis is important. Analysis of the nuclear internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome oxidase I (COI, also called CO1, COX1) loci have served as the basis of species identification assays that use allele-specific PCR amplification, restriction enzyme digestions, or genetic sequencing-based assays. Moreover, because the DNA data are interoperable with previous DNA records and often is linked to rich metadata on location and date of isolation, one can build information about population structure and movement of vector species to improve our understanding of the spatial epidemiology of malaria. Genetic analysis can be employed as a high-throughput approach to identify mosquito species. Morphological identification can be tedious when processing many specimens and comes with risk for misidentification of species not previously encountered and potentially cryptic species. In Ethiopia, much of the mosquito surveillance and identification is conducted using mosquito morphology, e.g. Once a technique is validated the diversity and distribution of various Anopheles species can be accurately determined and the proper intervention implemented. Meine Inhalte subNavigationMarker subNavigationPointerÄue to the global variation of Anopheles species and populations, it is vital to evaluate techniques specific to east Ethiopia to identify various Anopheles species.Mehr subNavigationMarker subNavigationPointer.Gebiete subNavigationMarker subNavigationPointer.